Skip to main content
Download PDF

Epigallocatechin -3- gallate mitigates diazinon neurotoxicity via suppression of pro-inflammatory genes and upregulation of antioxidant pathways

BMC Neuroscience volume 26, Article number: 22 (2025) Cite this article

Abstract

Diazinon is a commonly used organophosphate (OP) insecticide especially in developing countries for the control of insect pests, however, exposure to its toxic impact especially in humans and other non-target species remains an important public health concern. The study aimed to investigate the effect of epigallocatechin -3- gallate (EGCG), abundant in green tea plants on neurobehavioural, biochemical, and pathological changes in the brain of male Wistar rats following exposure to diazinon toxicity. Sixty adult male Wistar rats were acclimatized for seven days and subsequently randomly assigned into six treatment groups as follows: Group I: Control group (0.2 mL distilled water); Group II: Diazinon at 3 mg/kg (1% LD50); Group III: Diazinon (3 mg/kg) + EGCG (50 mg/kg, ~ 2% of LD50); Group IV: Diazinon (3 mg/kg) + EGCG (100 mg/kg, ~ 5% of LD50); Group V: EGCG (50 mg/kg) and Group VI: EGCG (100 mg/kg). All treatments were administered orally once daily for 14 days. Neurobehavioural studies, biomarkers of oxidative stress, histology, immunohistochemistry, and quantitative polymerase chain reaction (RT qPCR) were performed. Diazinon alone impaired recognition memory, increased oxidative stress markers and altered antioxidant defense in the brain. It upregulated TNF-α and IL-6 genes and repressed GPx 4 gene expressions. It was also associated with increased GFAP, Tau, and α-SN immunoreactivity. Microscopic examination revealed loss of Purkinje and hippocampal cells in brain. Co-treatment with EGCG however improved cognition, lowered oxidative stress markers, improved antioxidant status and suppressed TNF-α and IL-6. In conclusion, findings from this study demonstrated that EGCG offered protection against diazinon-induced neurotoxicity. Hence, natural sources of epigallocatechin -3- gallate such as fruits and vegetables could offer immense benefits by protecting against oxidative stress and inflammation in neurodegenerative disease conditions.

Clinical trial number Not applicable.

Peer Review reports

Introduction

Pesticide exposure remains a persistent public health concern especially among the subpopulations that by virtue of their occupation and/or routine activities are constantly in the vicinity where these compounds are either produced or applied [1–2]. Even in residential urban settings, the presence of pesticides or their metabolites on food stuffs and water meant for domestic purposes pose a source of exposure risk [3,4,5].

Diazinon is a commonly used organophosphate pesticide (OP) for the control of agricultural and household pests including insect vectors of human diseases [6]. It works as a contact insecticide and kills target pests by inhibiting acetylcholinesterase enzyme activity producing the so called “cholinergic crisis”. However, this mechanism is non-specific and affects both target pests and non-target species, including humans [7]. In the last few decades, however, diazinon as with many OP have been documented to produce oxidative stress (OS) and promote inflammation in tissues via the actions of reactive oxygen species [8–9]. This is of relevance because OS and chronic inflammation have been linked to the development of many chronic neurodegenerative diseases including cognitive disorders (such as Alzheimer’s disease, dementia) and motor disorders (such as Parkinson-like diseases) either as a causal factor or somewhat involved in the progression of these diseases [10–11]. Diazinon-induced neurotoxicity occurs in part via the induction of oxidative stress (OS), interference with antioxidant defense and promotion of neuroinflammation [12–13]. Previous studies have shown that diazinon exposure in Wistar rats resulted in progressive and/or persistent neurobehavioral deficits, impairment in cognitive functions and memory, as well as neurochemical alterations [13–14]. Hence, exposure to OP such as diazinon could have long-term global impact on human mental health such as cognition, learning, and memory. Therefore, unnecessary exposure to OP should be avoided and preventive measure in mitigation OP should be in place.

The cholinergic system includes neurons located in the basal forebrain and long axons that reach the cerebral cortex and the hippocampus. This system modulates cognitive function. Cognitive impairment is associated with progressive damage to cholinergic fibres, which leads us to the cholinergic hypothesis for Alzheimer’s disease (AD) as previously reported [15–16]. Alterations or dysfunction in noradrenergic and cholinergic systems have been shown to occur in each of the major neurodegenerative diseases of ageing, including Alzheimer’s disease, Parkinson’s disease, Lewy body dementia, frontotemporal dementia, and progressive supranuclear palsy [17–18]. Therefore, natural products including plat-derived products and synthetic agents have been reported to offer significant improvement in the cholinergic pathway thereby enhancing cognitive impairment [19,20,21,22,23].

Antioxidants are structurally and functionally diverse compounds that employ a variety of mechanisms to prevent the accumulation of ROS (and other prooxidants species) and therefore the development of oxidative stress in the body [24,25,26,27]. Investigations into their use to ameliorate or reverse the toxic effects of chemical and environmental pollutant exposures are actively ongoing. Much effort in this regard is focused on the identification and isolation of bioactive compounds from plants with health promoting potentials. Several antioxidants have been obtained from plants and investigated in a variety of neurological diseases [19,20,21; 26–27]. Epigallocatechin -3-gallate (EGCG) is a polyphenolic flavanol (or catechin) richly present in green tea plant (Camellia sinensis) [28–29]. A number of studies have shown that EGCG is endowed with antioxidant, anti-inflammatory, and immunomodulatory properties [30,31,32]. The take out from most of these studies is that EGCG employs complex mechanisms in exerting its health promoting attributes. There is however, a gap as to its efficacy in pesticide-exposed animals. This is crucial because different toxicants may employ unique mechanism(s) in promoting their cytotoxicity.

This study was therefore aimed at investigating the ameliorative effect of EGCG on neurobehavioural, biochemical, and histopathological changes induced by diazinon in the brain of exposed male Wistar rats. In clinical setting, supplementation and adequate intake of EGCG, a major polyphenol in green tea, holds promise in supporting cognition, memory, and learning due to its neuroprotective and neuro-enhancing properties. While preclinical evidence is promising, more clinical trials are needed to confirm its efficacy and optimal usage in humans.

Materials and methods

Experimental animals, housing and management

This research was conducted at the Experimental laboratory of the Department of Veterinary Physiology and Biochemistry, Faculty of Veterinary Medicine, University of Ibadan, Oyo State, Nigeria.

A total of sixty (60) adult male Wistar rats weighing between 180 and 200 g were used for the study. The rats were sourced from a pure breed rat’s colony in the Experimental Animal House of the Faculty of Veterinary Medicine, University of Ibadan. They were housed in spacious cages (5 rats/per cage) to minimize stress and enhance normal species-specific behaviour. The cages were kept in a well-ventilated room under natural lighting conditions of 12 h light and 12 h dark daily throughout the experimental period. They were fed commercially formulated broiler finisher feed produced by Top Feeds®. Feed and clean water was provided ad libitum. Dry wood shavings were used as litter material and this was regularly changed as required upon visual inspection. All experimental protocol implemented was in conformity with the guidelines of the Animal Research Review Panel [33] for the care and use of laboratory animals.

Acquisition and reconstitution of test compounds

Commercial grade diazinon marketed as Knock Out® 12% EC (100 ml, Agrochemical Nigeria Limited) was reconstituted in water to yield a 1.8 mg/ml working solution that was used for the study. Commercial grade EGCG 98% (HPLC) (5 g, LC44509PU2, AK Scientific®, USA) was used for this study. It was reconstituted in dimethyl sulfoxide (DMSO) into a 100 mg/mL working solution and stored at 4ºC throughout the experimental period.

Experimental design

A completely randomized design was used for the study. After seven (7) days of acclimatization, the rats were weighed using a digital weighing scale to obtain their initial weight. They were then randomly assigned to six (6) independent treatment groups. Each group had ten (10) rats. All treatments were administered by oral gavage once daily for 14 days. The various treatment groups were as follows (see Table 1):

Group I: Control group (0.2 mL distilled water).

Group II: Diazinon (3 mg/kg representing 1% LD50).

Group III: Diazinon (3 mg/kg) + EGCG (50 mg/kg which represents 2% LD50).

Group IV: Diazinon (3 mg/kg) + EGCG (100 mg/kg which represents 5% LD50).

Group V: EGCG (50 mg/kg).

Group VI: EGCG (100 mg/kg).

Table 1 Experimental design
Full size table

The dosage of diazinon was based on the work of Ajibade et al. [34], while that of EGCG was selected from the findings of Isbrucker et al. [35]. Any sign of adverse reaction was recorded daily. On days 10 to 12 of the experiment, neurobehavioural evaluations were performed on the rats using appropriate test procedures. All rats were sacrificed on day 15 of the experiment. Five (5) rats were randomly selected from each group, sacrificed by quick cervical dislocation and brains harvested for biochemical and PCR assay. Harvested brains were stored at -20ºC until analysed. The remaining 5 rats were euthanised with ketamine (100 mg/kg, i.p.); they were then perfused intracardially with normal saline first and then 10% phosphate buffered formalin (PBF). Brains were harvested and post-fixed in PBF for 5 days and thereafter subjected to histological procedures for histopathological and immunohistochemical analysis [36]. All experimental protocol was implemented in conformity with the guidelines of the Animal Research Review Panel for the care and use of laboratory animals. Ethical approval for the study and consent for the use of animals was obtained from University of Ibadan, Animal Care and Use Research Committee (UI-ACUREC) with approval number UI-ACUREC/059–0324/28.

Neurobehavioural evaluation

The following tests were conducted to assess neurobehavioural function: open field test, elevated plus maze (EPM) test, novel object recognition test, and hanging wire test. Tests were performed on days 10–12 (Table 2).

Open field test (OFT)

Anxiety and general motor function were assessed using an OFT initially developed by Hall [37] and modified by several researchers through the years. The open field apparatus was a 100 cm-by-100 cm-by-80 cm box. The floor was divided into 16 small squares with a centre square. The assessment time for each rat was 5 min after which the apparatus was thoroughly cleaned with methylated spirit to remove any previous animal’s odour which may confound test results. The variables recorded include number of squares crossed, frequency of entry into centre square, frequency of rearing and grooming, and number of faecal bolus(es) passed out. Tests were carried out on experimental day 12.

Elevated plus maze (EPM) test

This test is used to evaluate anxiety-like behaviour in rat and other rodents. It is based on their reluctance to enter ‘unprotected’ spaces balanced out by their innate desire for exploration in a new environment. The EPM apparatus has two oppositely placed open and closed arms with a small centre area in between where the rat is dropped. The time spent in these 3 compartments (open, closed and centre) within a 5 min period was recorded [38]. This test was performed on experimental day 12.

Hanging wire test

This test as described [39] is used to evaluate muscle strength in rats. Each rat was hung with its fore paw on a wire support, at a height of about 60 cm and the time until it drops to the floor is recorded [40]. Each rat will be allowed three trials with a resting period between consecutive attempts of 5 min. The average duration for each rat was then recorded. This test was performed on experimental day 12.

Novel object recognition test (NORT)

This test is used to evaluate cognition in rats as it relates to different aspects of learning and memory [41]. A general description for the test is as follows: in an open field box, the rats are first familiarized with two identical objects (habituation phase). Twenty-four hours later (test phase) one of the objects is replaced with a new object and the rats are allowed to explore both objects for 5 min and the time spent exploring each object was recorded. NORT was performed on experimental days 10–12; rats were trained on days 10 and 11 and tests carried out on day 12.

Table 2 Protocol schedule
Full size table

Tissue biochemical assay

Tissue homogenization

The brain samples were homogenized in buffer (0.1 M Phosphate Buffer, pH 7.4) at a dilution ratio of 1:8 using a Teflon® homogenizer. The resulting homogenate was then centrifuged using a cold centrifuge at 10,000 rpm for 10 min at 4ºC. The resulting supernatant was collected into plain sample bottles and stored at -20ºC until use.

Determination of biomarkers of oxidative stress and antioxidant status

Lipid peroxidation was evaluated by measuring the formation of Thiobarbituric Acid Reactive Substances (TBARS) according to previously described methods [42]. Hydrogen Peroxide concentration was determined as described [43], reduced glutathione content was measured [44] and glutathione Peroxidase activity was determined [45]. The activity of SOD was determined as previously described [46] and with a slight modification [47]. Glutathione S-transferase was determined as described [48]. The concentration of nitric oxide (NO) was determined using Griess reagent [49].

Determination of acetylcholinesterase (AChE) activity

The activity of AChE in brain samples was determined as previously described [50].

Gene expression analysis

Real time quantitative polymerase chain reaction (qPCR) assay to quantify mRNA levels of glutathione peroxidase (GPx), interleukin 6 (IL-6), and TNF-α in the brain heart and kidneys was conducted [51].

Procedure

Total RNA extraction, RNA quality control, and cDNA synthesis

Total RNA was extracted using a modified Cetyltrimethyl ammonium bromide (CTAB) extraction protocol. The extracted RNA was then treated with NEB DNase 1 (M0303) to totally eliminate extracted DNA.

Gene quantification

Gene quantification was performed using Luna® Universal qPCR Master Mix (New England Biolabs, Massachusetts, USA) protocol (M3003). Actin was used as internal control.

Primer design

Gene

Forward primer seq

Reverse primer sequence

GPX4

CCGATATGCTGAGTGTGGTTTA

GGCTGCAAACTCCTTGATTTC

TNF-Alpha

TCTTCAAGGGACAAGGCTGC

CTTGATGGCAGAGAGGAGGC

IL6

GCAAGAGACTTCCAGCCA

CTGGTCTGTTGTGGGTGG

actin

AGCCATGTACGTAGCCATCC

ACCCTCATAGATGGGCACAG

Immunohistochemistry

Immunohistochemical staining to visualize and quantify tissue expression level for the following proteins: glial fibrillary associated protein (GFAP), alpha synuclein and tau protein was as described by Oyagbemi et al. [24]. Slight modification using 2-step plus Poly-HRP Anti Mouse/Rabbit IgG Detection System with DAB solution (Catalog number: E-IR-R217 from Elabscience Biotechnology®, China) was employed.

Statistical analysis

All values obtained were expressed as mean ± standard error. One-way analysis of variance (ANOVA) was used to test for significance at p < 0.05 and Tukey HSD post-hoc test was used for pair-wise comparison [52]. All analysis was performed using “GraphPad Prism 8” statistical software.

Results

Effect of treatment on neurobehavioural assessments and cognitive functions

Open field test/maze

There was a significant (p < 0.05) decrease in the number of lines crossed in rats that received only diazinon compared to the control (Fig. 1A). Rearing frequency and frequency of entry into centre square was also significantly (p < 0.05) reduced in the diazinon alone group compared to their control counterpart. When compared to the diazinon only group, co-treatment with EGCG significantly increased (p < 0.05) the rearing frequency but not the number of lines crossed or the frequency of entry into the centre square (Fig. 1B-C). Grooming frequency was not significantly different (p > 0.05) in rats that received diazinon alone relative to the control (Fig. 1D).

Fig. 1
figure 1

Open Field Maze (OFM) results of rats treated with diazinon (DZN) and/or epigallocatechin -3- gallate (EGCG) for 14 days. Values are means ± SEM (n = 10). Alphabet “a” indicates significant difference when compared to the control at P < 0.05 while “b” indicates significant difference when compared to diazinon only (DZN) group at P < 0.05. Mean ± SEM (n = 10)

Full size image

Elevated plus maze (EPM) test

The time spent in either the closed or open arm of the EPM apparatus was significantly affected by the treatments (Fig. 2). Rats that received diazinon alone spent significantly less time (p < 0.01) in the open arm (Fig. 2A) and significantly (p < 0.05) more time in the closed arm of the apparatus compared to those in the control group (Fig. 2B). However, co-treatment with EGCG at 50 mg/kg significantly increased (p > 0.05) the time spent in the open arm, while the time spent in the closed arm was significantly decreased (p > 0.05) following co-treatment with EGCG at both dosage levels, as shown in Fig. 2A&B. Interestingly, EGCG alone at 50 mg/kg significantly improved (p > 0.05) the time spent in the open arena of the plus maze compared to the control.

Fig. 2
figure 2

Elevated plus maze results of rats treated with diazinon (DZN) and/or epigallocatechin -3- gallate (EGCG) for 14 days. Values are means ± SEM (n = 10). Alphabet “a” indicates significant difference when compared to the control at P < 0.05 while “b” indicates significant difference when compared to diazinon only (DZN) group at P < 0.05. Mean ± SEM (n = 10)

Full size image

Novel object recognition

The recognition index for novel object was decreased significantly (p > 0.05) in rats exposed to diazinon alone relative to the untreated control, while a corresponding significant improvement (p < 0.05) in the recognition index was observed following co-treatment with EGCG at 100 mg/kg (Fig. 3A). Interestingly, recognition index in rats was significantly increased (p > 0.05) by EGCG alone at 50 mg/kg compared to the control.

Hanging wire test

The latency until fall decreased (p < 0.05) significantly in the rats treated with diazinon alone compared to control. Co-administration of EGCG did not significantly increase (p > 0.05) the hanging latency when compared to the diazinon alone group (Fig. 3B). Latency to fall was also significantly decreased (p > 0.05) by EGCG alone at 100 mg/kg compared to the control.

Fig. 3
figure 3

Wire hang test and novel object recognition test (NORT) results of rats treated with diazinon (DZN) and/or epigallocatechin -3- gallate (EGCG) for 14 days. Values are means ± SEM (n = 10). Alphabet “a” indicates significant difference when compared to the control at P < 0.05 while “b” indicates significant difference when compared to diazinon only (DZN) group at P < 0.05. Mean ± SEM (n = 10)

Full size image

Effect of treatment on tissue biochemical parameters

Treatment with diazinon alone significantly increased MDA contents in the cerebrum (p < 0.01) and cerebellum (p < 0.01) of rats compared to control group. A corresponding decrease in MDA levels (p < 0.05) was however observed following co-treatment with EGCG at 50 mg/kg and 100 mg/kg respectively compared to the diazinon alone group, as shown in Fig. 4A-B. Treatment with diazinon alone significantly increased hydrogen peroxide (H2O2) generation in the cerebrum (p < 0.05) and cerebellum (p < 0.05) of rats compared to the untreated controls while H2O2 concentration in these tissues was significant (p < 0.05) lowered by the co-treatment of rats with EGCG at both 50 mg/kg and 100 mg/kg respectively compared to the diazinon alone group, as shown in Fig. 4C-D. GSH levels were found to decrease (p < 0.05) significantly in the cerebrum and cerebellum of diazinon alone exposed rats compared to control, while co-treatment with EGCG at 50 mg/kg and 100 mg/kg significantly increased GSH (p < 0.05) in the cerebrum and cerebellum respectively compared to the diazinon alone group, as shown in Fig. 4E-F.

Fig. 4
figure 4

MDA concentration (µmol/ mg protein) of rats treated with diazinon (DZN) and/or epigallocatechin -3- gallate (EGCG) for 14 days. Values are means ± SEM (n = 10). Alphabet “a” indicates significant difference when compared to the control at P < 0.05 while “b” indicates significant difference when compared to diazinon only (DZN) group at P < 0.05. Mean ± SEM (n = 10)

Full size image

The activity of GPx reduced significantly (p < 0.05) in the cerebrum and cerebellum of rats treated with diazinon alone compared to the untreated controls. However, in combination with EGCG at 50 mg/kg and/or 100 mg/kg, GPx activity improved significantly in the cerebrum and cerebellum at p < 0.05 (Fig. 5A-B). Treatment with diazinon alone significantly increased (p < 0.05) SOD activity in the cerebrum and cerebellum of rats relative to those in the control group. Interestingly, relative to the diazinon alone group, co-treatment with EGCG did not significantly reduce (p > 0.05) SOD activity in these brain regions to levels observed in the untreated controls (Fig. 5C-D). In both brain regions (cerebrum and cerebellum) GST enzyme activity did not show any significantly change in rats treated with diazinon alone compared to those in the untreated control group (Fig. 5E-F).

Fig. 5
figure 5

GPX activity of rats treated with diazinon (DZN) and/or epigallocatechin -3- gallate (EGCG) for 14 days. Values are means ± SEM (n = 10). Alphabet “a” indicates significant difference when compared to the control at P < 0.05 while “b” indicates significant difference when compared to diazinon only (DZN) group at P < 0.05. Mean ± SEM (n = 10)

Full size image

Effect on brain nitric oxide (NO) content and acetylcholinesterase (AChE) activity

Nitric oxide (NO) level was increased significantly (P < 0.05) in the cerebrum and cerebellum of rats treated with diazinon alone compared to the control group. Conversely, co-treatment with EGCG at 50 mg/kg and 100 mg/kg significantly lowered NO levels (P < 0.05) in these brain regions when compared to the diazinon alone group, as shown in Fig. 6A-B.

Cerebral and cerebellar AChE activity of was significantly increased in rats treated with diazinon alone (P < 0.05) compared to the untreated control. However, in both brain regions, co-treatment with EGCG at 100 mg/kg significantly lowered AChE activity (P < 0.05) relative to the diazinon alone group. Interestingly, EGCG alone inhibited the activity of AChE in the cerebrum (at both 50 mg/kg and 100 mg/kg) and cerebellum (at 100 mg/kg only) compared to the control, as shown in Fig. 6C-D.

Fig. 6
figure 6

Nitric oxide (NO) content and acetylcholinesterase (AChE) of rats treated with diazinon (DZN) and/or epigallocatechin -3- gallate (EGCG) for 14 days. Values are means ± SEM (n = 10). Alphabet “a” indicates significant difference when compared to the control at P < 0.05 while “b” indicates significant difference when compared to diazinon only (DZN) group at P < 0.05

Full size image

Effect of treatment on gene expression for glutathione peroxidase 4 (GPX 4), Interleukin 6 (IL 6) and tumour necrosis factor alpha (TNF-α)

Exposure of rats to diazinon alone significantly suppressed (p < 0.05) GPx 4 enzyme gene expression and upregulated (p < 0.05) those of TNF-α and IL 6 relative to the untreated control group. Interestingly, compared to the diazinon alone group, co-treatment with EGCG significantly suppressed TNF-α and IL 6 expression (p < 0.05) in a dose dependent manner while GPx 4 expression was significantly upregulated at p < 0.05, as shown in Fig. 7A-C.

Fig. 7
figure 7

GPx 4 gene expression level of rats treated with diazinon (DZN) and/or epigallocatechin -3- gallate (EGCG) for 14 days. Values are means ± SEM (n = 10). Alphabet “a” indicates significant difference when compared to the control at P < 0.05 while “b” indicates significant difference when compared to diazinon only (DZN) group at P < 0.05

Full size image

Effect of treatment on neurons, alpha synuclein, glial fibrillary associated protein and Tau protein expression

Cresyl-stained sections of the rats’ cerebellum revealed Purkinje cells loss, and reduction in dendritic arborisation in DZN-treated rats. This neurodegeneration was rescued with EGCG administration (Fig. 8). The CA2 (Fig. 9) and CA3 (Fig. 10) hippocampal regions of rat brain treated with diazinon (DZN) alone showed relatively decreased cell number compared to the EGCG co-treated groups.

Fig. 8
figure 8

Cresyl violet stain, cerebellum of rat brain treated with diazinon (DZN) and/or epigallocatechin -3- gallate (EGCG) for 14 days. Sections were stained with cresyl violet stain with bold arrows showing Purkinje cell death and loss of dendritic arborization in rats treated with DZN; this was rescued with EGCG administration. Scale bar– 50 μm

Full size image
Fig. 9
figure 9

Cresyl violet stain, hippocampal CA2 region of rat brain treated with diazinon (DZN) and/or epigallocatechin -3- gallate (EGCG) for 14 days. Note the neuronal cell loss observed with DZN administration, which was rescued with treatment with EGCG. Scale bar– 50 μm

Full size image
Fig. 10
figure 10

Cresyl violet stain, hippocampal CA3 region of rat brain treated with diazinon (DZN) and/or epigallocatechin -3- gallate (EGCG) for 14 days. Note the severe neurodegeneration observed with DZN administration and the mitigation due DZN administration. Scale bar– 50 μm

Full size image

The cerebral cortical sections of the rats treated with diazinon revealed more immunoreactivity of α-synuclein protein compared to the control. This intensity was however moderated with fewer localizations of deeply stained sections following co-treatment with EGCG (Fig. 11).

Fig. 11
figure 11

Immunohistochemical photomicrograph of α-synuclein protein expression in rat hippocampus (CA1) treated with diazinon (DZN) and/or epigallocatechin -3- gallate (EGCG) for 14 days. Slides were stained with high-definition Haematoxylin with bold arrows showing α- synuclein protein. Scale bar– 200 μm

Full size image

Astrocytic (GFAP) immunostaining revealed an increase in astrocytic number and a more pronounced staining intensity especially in the cerebellar regions in rats exposed to diazinon alone, compared to the untreated controls. Co-treatment with EGCG also resulted in a less astrocytic activation relative to the diazinon alone group (Fig. 12).

Fig. 12
figure 12

Immunohistochemical photomicrograph of glial fibrillary acidic protein (GFAP) expression in cerebellum treated with diazinon (DZN) and/or epigallocatechin -3- gallate (EGCG) for 14 days. Slides were stained with high-definition Haematoxylin with bold arrows showing GFAP. Scale bar– 200 μm

Full size image

There were more localized and deeply staining areas showing immunoreaction with tau proteins in rats exposed to diazinon alone compared to the control group. This intensity was however more moderated and diffused in rats co-treated with EGCG compared to the diazinon alone group (Fig. 13).

Fig. 13
figure 13

Immunohistochemical photomicrograph of tau protein expression in rat brain treated with diazinon (DZN) and/or epigallocatechin -3- gallate (EGCG) for 14 days. Slides were stained with high-definition Haematoxylin, with bold arrows showing tau proteins. Scale bar– 500 μm

Full size image

Discussion

Diazinon is a commonly used organophosphate (OP) insecticide in developing countries and exposure to its toxic impact especially in humans and other non-target species remains an important public health concern. It is well documented that oxidative stress coupled with significant alteration in overall endogenous antioxidant defence contributes to the toxicity caused by OPs. This study was set out to investigate the role of EGCG in ameliorating the toxic effects of diazinon in the brain of male Wistar rats.

The open field maze (OFM) test is a conventionally used technique in investigating the influence of various pharmacological and non-pharmacological compounds on neurobehavioural performance using small rodent models such as rats and mice [53–54]. This is based on parameters of the test that evaluate locomotor, emotionality and/or anxiety-related behaviour in these species [53]. Our study revealed that exposure of rats to diazinon alone significantly reduced ambulatory (locomotor) activity compared to the untreated control group. This may be indicative of increased anxiogenic tendencies in these rats. It can be argued that the significant dissimilarity in ambulation which is indicative of inactivity may confound the treatment effect, further spatial analysis of the open field data may be used to discriminate anxiety-related behaviour from ambulation. First, rats in the diazinon alone group generally explored the open field maze to a significantly lesser degree as shown by the frequency of centre crossings in the OFM box compared to those in the control group. Furthermore, they demonstrated significantly increased thigmotaxic tendencies (movement along walls) evaluated by the significantly decreased frequency of entry and crossing of the centre square. Increased thigmotaxis correlates positively with increased levels of anxiety in rodents [54]. Second, rearing behaviour is considered an exploratory behaviour in rats and mice and is also used as a measure of anxiety in these species [55]. The significantly decreased rearing frequency in diazinon-exposed rats relative to those in the control group may also suggest increased levels of anxiety-related behaviour and/or emotionality in these animals [56]. Although, OFM results may be difficult to interpret, studies have indicated that rearing behaviour and ambulatory activity are reliable indices for emotionality in rats in a novel setting [57–58]. Third, OFM test results were similar to those obtained from the Elevated Plus Maze (EPM) test. This test is also used score emotionality in rats and is based on the balance between their avoidance of elevated and unprotected (open) spaces and their innate tendency to explore new areas [56]. The fact that diazinon alone-exposed rats stayed for longer duration in the closed areas and shorter duration in the open areas of the apparatus may also be indicative of increased display of emotionality and reduced exploratory tendencies. The number of fecal boli expelled by diazinon intoxicated rats (results not shown) was also significantly higher than those in the control group. Increased defecation was shown by [37] to correlate with increased levels of anxiety in rats. However, the validity of this measure as an index of anxiety-like behaviour has been mixed and still remains unclear. Taken together therefore, the decreased exploration of the entire open field space by diazinon alone treated rats may be attributed to increases inactivity, increased thigmotaxic behaviour or increased emotionality and/or anxiety-linked behaviour induced by diazinon. Increased thigmotaxic behaviour and reduced exploration of the open field maze should however be regarded as a preliminary test which should be supported with more specific anxiety-related tests. Dopaminergic receptors are known to be involved in the regulation of emotionality in rats. Enhanced anxiogenic behaviour in novelty may therefore be related to impaired dopaminergic activity in higher cortical brain centres. This dysfunction in dopaminergic neuron activity may be induced via interaction with D1 and D2 receptors or following increased loss of dopaminergic neurons in specific regions of the brain [14, 59–60]. Whether diazinon or its breakdown metabolic products directly interact with dopaminergic receptors is unclear. However, studies show that organophosphate pesticide intoxication in rats is associated with increased generation of reactive oxygen species (ROS), inflammation and increased expression of proapoptotic markers in rat brain [61,62,63]. These results improved in the co-treated rats and those exposed to EGCG alone at 50 mg/kg suggesting a role of EGCG in decreasing emotionality and improving exploratory behaviour in rats. Recognition memory in diazinon alone-exposed rats was severely impaired. This was however improved following co-treatment with 100 mg/ kg of EGCG and EGCG alone at 50 mg/kg. Neurobehavioural deficit following organophosphate pesticide intoxication have been reported in other studies (16, 64–65). Chlorpyrifos, a commonly used OP was reported by [64–65] to induce oxidative stress; enhance anxiety in rats and impair neuro-cognitive function. Delavar et al. [16] had previously demonstrated that diazinon exposure in male Wistar rats impaired spatial memory. Hawkey et al. [14] reported that developmental exposure of rats to diazinon resulted in neurochemical alteration with progressive neurobehavioural deficit which persisted into adulthood. Diazinon exposure in rats was also reported to impaired learning and memory [66]. The improved cognitive function in rats co-treated with EGCG or EGCG alone may be related to its ability to improve emotionality, enhance antioxidant defence against oxidative damage and/or modulate neurochemical homeostasis in brain regions involved with cognitive functions [14, 64,65,66]. In our study, the inhibition of AChE by EGCG may have contributed to enhanced levels of the neurotransmitter, acetylcholine, known to facilitate neuronal communication. The link between activity of cholinergic neurons and recognition memory is still being explored [66]. The inability of EGCG either alone or in combination with diazinon to improve muscular strength to the level observed in the control group may indicate impairment in neuromuscular integrity. Both diazinon and EGCG have been documented to interfere with AChE activity [66].

Diazinon alone increased oxidative stress (OS) makers and altered antioxidant defense in the brain. A conventionally used OS markers namely: MDA, a stable molecular product of lipid oxidation (or peroxidation); and hydrogen peroxide (H2O2), a ROS were both elevated following treatment with diazinon alone when compared to the untreated control group. This increase is suggestive of increased ROS generation in the brain. The oxidative metabolism of xenobiotics (including diazinon) by enzymes of the cytochrome P450 monooxygenase system and other oxidoreductases (such as NADPH oxidases or NOXs) have been reported to be accompanied by increased generation of reactive oxygen and nitrogen species in the cell [67–68]. Overproduction of these highly reactive electrophilic species may overwhelm the body’s antioxidant defence capacity resulting in a net shift in redox homeostasis in the towards a prooxidative state. More importantly however is that reactive radical species may begin to attack susceptible cellular biomolecules including lipids, proteins and nucleic acid required for cellular stability and survival [69]. Among the most susceptible lipid fractions are the polyunsaturated fatty acids which undergo increases peroxidative damage yielding a variety of stable oxidation by-products which can be quantified spectrophotometrically [70]. Neuronal cells are richly endowed with PUFAs as such may be selectively susceptible to lipoperoxidative damage by ROS following impairment in antioxidant defense. Rats in the diazinon alone group also showed significantly increased SOD activity, relatively normal GST activity and at least in one brain region, depletion of GSH and/or decreased GPx activity. Studies that show OPs mediate their neurotoxic actions in part by inducing OS and impairing antioxidant defenses have been reported [71]. The depletion of GPx and its cofactor GSH may indicate increased utilization for peroxide decomposition into less toxic forms that is more easily eliminated [72]. SODs primarily convert superoxides to H2O2 and may be considered as a first line of defence against increased superoxide radical production [73]. The observed increase in their activity may therefore be suggestive of some kind of ROS-mediated enzyme induction. GSTs are an important family of phase two detoxifying enzyme and play a cytoprotective role in cells under chemical stress via enhanced adaptive response mechanisms [74]. SODs and GSTs are components of the adaptive response system that enables the body cope with stress induced by environmental pollutants [75,76,77]. Increase in SOD activity in Wistar rats exposed to permethrin, a pyrethroid pesticide compound has been earlier reported by [78]. Non-chemical stress in wistar rats have also been reported to induce SOD activity [78]. The significant increase in the activities of SOD, GPx, and GST in group intoxicated with diazinon could be attributed with adaptive response which has been extensively reported in literature elsewhere [79–80]. The lowering of OS and improvement in antioxidant defence in rats co-treated with EGCG is therefore suggestive its antioxidant role.

Nitric oxide (NO) level in rats exposed to diazinon alone was significantly elevated in the cerebrum and cerebellum, the brain region generally involved in cognition, memory and learning, muscle activity and other motor functions. This may indicate increased levels of oxidative stress in these brain areas. Nitric oxide is an important physiological molecule that facilitates neuronal communication and function in the brain [81]. However, conditions that induce uncontrolled production of this free radical may result in the promotion of its neurotoxic effect via the promotion of oxidative stress, apoptosis and neuronal damage [82–83]. In the presence of the superoxide radical, NO is oxidized to peroxynitrite anion (ONOO −), a potent apoptotic molecule [82]. The lowering of NO levels in these brain regions following co-treatment of rats with EGCG is suggestive of its ability to offer neuroprotection by reducing oxidative stress and improve NO metabolism.

Our study also revealed that repeated exposure of rats to diazinon alone enhanced that activity of AChE in the cerebrum and cerebellum. This increased enzyme activity may be due to increased rate of spontaneous reactivation of phosphorylated (inhibited) enzyme [84]. Generally, organophosphate (OP) compounds are known cholinesterase inhibitors; however, the toxicity of individual OP compounds also depends on the exposure doses and stability of the inhibited (phosphorylated) enzyme. The ability of EGCG both in combination with diazinon or alone to decrease the activity of AChE may suggest its role in improving brain acetylcholine levels and the activity of cholinergic neurons [27, 66].

Intoxication with diazinon alone suppressed expression of glutathione peroxidase 4 (GPx 4), a selenoprotein antioxidant molecule involved in the neutralization of peroxides [85–86]. Furthermore, diazinon alone exposure in rats increased expression of IL-6, a pro-inflammatory cytokine and potent mediator of inflammation [87]. TNF-α expression was also increased in diazinon alone exposed rats. TNF-α is considered as a multi-functional cytokine that is involved in cellular immunity [88–89]. At low levels this protein plays a beneficial role in activating host defense response. However, overproduction may induce systemic inflammatory response and wide spread tissue damage [89]. Taken together, diazinon exposure impairs brain antioxidant defense and contributes to the development of a state of neuroinflammation. Co-administration of EGCG enhanced GPx 4 expression and repressed IL 6 and TNF-α expression which is suggesting its role in the activation of oxidative stress-related genes (such as GPx 4), anti-inflammatory and immunomodulatory effects.

Intracellular proteins facilitate important cellular processes and provide structural support within the cell. Their visualization, analysis, and quantification in the cell under specific conditions may provide invaluable insight into their function and more crucially, any underlying physiological and/or pathologic process occurring within the cell. In this study, results from immunohistochemical staining for specific proteins in the brain revealed the following:

The increased deposition of alpha synuclein (α-SN) in the brain of diazinon alone treated rats over those observed in the control group and their subsequent reduction following co-treatment with EGCG may be indicative of increased expression of α-SN in the brain. α-SN is a soluble unfolded motor protein that may be thought to be associated with the cytoskeletal network of the cell and facilitates and/or regulate vesicular transport within the cell, exocytosis (especially of neurotransmitters) and endocytosis [90]. Increased insoluble aggregate of α-SN are associated with many neurodegenerative conditions such as Parkinson’s disease and other dementia-like diseases or synucleinopathies [91,92,93]. Neurodegeneration involves progressive loss of neurons in the brain [94]. α-synuclein, a protein critically involved in Parkinson disease. We hypothesized that exposure to organophosphates such as diazinon could precipitate Parkinson-like disease as indicated with loss of muscular strength [93, 95].

Conditions such as changes in α-SN gene function due to mutation or altered gene expression, accumulation of cytotoxic substance or even aging those results in excessive, misformed or misfolding and aggregation of α-SN may result in impaired cytoskeletal function, loss of neurotransmitter release, and neuronal death [90,91,92, 95]. Modulation of increased α-SN immunodeposition by EGCG co-treated rats may be suggestive of its neuroprotective effect.

Immune reactivity to glial fibrillary acidic protein (GFAP) in diazinon alone treated rats was higher than in untreated controls while co-treatment with EGCG resulted in lowering of GFAP synthesis. GFAP is a protein involved with the cytoskeletal support system in the cell and the regulation of specific neurotransmitter necessary for proper brain function [96]. It is a relevant astrocytic marker in the brain. High levels of this protein in brain may be indicative of increased astrocyte activation [96]. Astrocytes are important neuroglial or supporting cells with multifunctional role in the CNS as well as participation in immune responses [97]. In the presence of injury and/or brain damage, astrocytes have been reported to increase the expression of GFAP [98]. Amelioration of GFAP reactivity in the astrocytes of co-treated rats with EGCG may indicate this antioxidant’s role in immunomodulation and neuroprotection.

The deposition and/or expression of tau protein were higher in diazinon alone intoxicated rats compared to the untreated controls. This may be indicative of neurotoxicity. Tau is an “intrinsically disordered” (or “natively unfolded”) protein that plays a role in the stabilization of tubulin sub units in neurons [99]. This microtubulary system is necessary for the cell division and translocation of substances within the neuron [100–101]. Studies show that to be active, tau requires phosphorylation by specific kinases [102]. However, mutational modification of tau genes, oxidative stress, neuronal injury and/or neuroinflammation may activate kinases resulting in the hyperphosphorylation of tau [102,103,104]. Hyperphosphorylated tau is susceptible to misfolding, oligomerization, and aggregation [103]. Aggregation of tau into neurofibrillary structures results in loss of function and is resistant to proteosomal processing and degradation [102–103]. The loss of microtubule integrity results in their catastrophic collapse, neuronal death, and progressive neurodegeneration. Increased deposition of tau has been associated with learning and memory deficit and impaired cognitive function [103–104]. Fewer depositions of tau proteins following co-treatment with EGCG may be indicative of its neuroprotective effect.

Microscopic examination of the brain of rats treated with diazinon alone, revealed decrease in Purkinje and hippocampal cells. This may be suggestive of increased neuronal loss in these brain regions. Increased levels of proapoptotic markers, neuronal damage and neuroinflammation have been reported following exposure of rats to OPs [62–63]. The increased neuronal cell count in these brain regions of rats co-treated with EGCG may suggest a neuroprotective role of this compound via the inhibition of neuronal apoptotic loss.

Conclusion

This study has demonstrated that repeated low dose exposure of rats to diazinon is associated with toxicity in the brain by inducing OS, impairing antioxidant defence, suppressing GPx 4 gene expression, promoting inflammatory cytokines release and altering the levels of relevant tissue proteins involved in facilitating various cellular processes in these tissues. At the same time, EGCG, a flavanol and abundant in green tea ameliorated and, in some instances, completely reversed the toxic effect of diazinon in these tissues by employing complex mechanisms including lowering oxidative stress, improving antioxidant defence, upregulating GPx 4 expressions, and decreasing inflammation. The cytoprotective effects of EGCG at 50 mg/ kg was comparable to those produced at 100 mg/ kg in nearly all instances which is indicative of the potency (or efficacy) and safety of EGCG as an antioxidant.

Data availability

Data is provided within the manuscript or supplementary information files and is available on reasonable request from corresponding author.

References

  1. Udoh GD, Gibbs JL, Commentary. Highlighting the need for pesticides safety training in Nigeria: A survey of farm households in rivers state. FPUBH. 2022;10:988855.

    Google Scholar 

  2. Kumar D, Sinha SN. Chronic exposures to cholinesterase-inhibiting pesticides adversely affects the health of agricultural workers in India. Environ Res. 2024;252:118961.

    Article  CAS  PubMed  Google Scholar 

  3. Ganaie MI, Jan I, Mayer AN, Dar AA, Mayer IA, Ahmed P, Sofi JA. Health risk assessment of pesticide residues in drinking water of upper Jhelum region in Kashmir Valley-India by GC-MS/MS. Int J Anal Chem. 2023;2023:6802782.

  4. Omokpariola PL, Okoye PA, Okechukwu VU, Omokpariola DO. Concentration levels and risk assessment of organochlorine and organophosphate pesticide residue in selected cereals and legumes sold in Anambra State, south-eastern Nigeria. Phys Sci Rev. 2024;9(3):1353–73.

    Google Scholar 

  5. Adelodun AA, Ajibade S, Fadaini O, Oluwasina O, Ibigbami O. Organochlorine pesticide and total petroleum hydrocarbon pollution of Ilaje coastal river sediments, Ondo State, Nigeria. Environ Protect Res (EPR). 2024;4(1):60–75.

    Article  Google Scholar 

  6. Tibebu A, Assefa A. 2023. Acaricidal efficacy evaluation of amitraz and diazinon against Amblyomma variegatum tick species in Waghimra zone, northern Ethiopia. Vet Parasitol Reg Stud Reports. 2023; 42:100885.

  7. Iheji CC, Onu NN, Nduagubam OC, Usuah JA, Iheji GU, Ndu IK. Childhood poisoning: a 10-year experience in a tertiary hospital in Enugu State, Nigeria. Emerg Care. 2024;20:12351.

    Google Scholar 

  8. Sule RO, Condon L, Gomes AV. A common feature of pesticides: oxidative stress- the role of oxidative stress in pesticide-induced toxicity. Oxid Med Cell Longev 2022; Jan 19:20225563759. https://doiorg.publicaciones.saludcastillayleon.es/10.1155/2022/5563759.2022:5563759

  9. Wang A, Wan Y, Qi W, Mahai G, Qian X, Zheng T, Xia W. Urinary biomarkers of exposure to organophosphate, pyrethroid, neonicotinoid insecticides and oxidative stress: A repeated measurement analysis among pregnant women. Sci Total Environ. 2024;912:169565.

    Article  CAS  PubMed  Google Scholar 

  10. Yang J, Luo J, Tian X, Zhao Y, Li Y, Wu X. Progress in Understanding oxidative stress, aging, and Aging-Related diseases. Antioxidants. 2024;13(4):394.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Houldsworth A. Role of oxidative stress in neurodegenerative disorders: A review of reactive oxygen species and prevention by antioxidants. Brain Commun. 2024;6(1):fcad356.

    Article  PubMed  PubMed Central  Google Scholar 

  12. Delavar A, Anbarkeh FR, Baradaran R, Arab Z, Moghaddam SHR, Hosseini M, Jalali M. The protective effect of methanolic extract of Verbascum cheiranthifolium and Biebersteinia multifida DC on hippocampus damage induced by Diazinon in male Wistar rats: an experimental study. J Chem Neuroanat. 2024;137:102398.

    Article  CAS  PubMed  Google Scholar 

  13. Karimani A, Ramezani N, Goli AA, Shirazi MHN, Nourani H, Jafari AM. Subchronic neurotoxicity of Diazinon in albino mice: impact of oxidative stress, ache activity, and gene expression disturbances in the cerebral cortex and hippocampus on mood, Spatial learning, and memory function. Toxicol Rep. 2021;8:1280–88.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Hawkey AB, Pippen E, Kenou B, Holloway Z, Slotkin TA, Seidler FJ, Levin ED. Persistent neurobehavioral and neurochemical anomalies in middle-aged rats after maternal Diazinon exposure. Toxicol. 2022;472:153189.

    Article  CAS  Google Scholar 

  15. Yamamoto M, Itokazu T, Uno H, Maki T, Shibuya N, Yamashita T. Anti-RGMa neutralizing antibody ameliorates vascular cognitive impairment in mice. Neurother 2024 Nov 28:e00500. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.neurot.2024.e00500. Epub ahead of print. PMID: 39613526.

  16. Tok F. Recent Studies on Heterocyclic Cholinesterase Inhibitors Against Alzheimer’s Disease. Chem Biodivers. 2024 Nov 26:e202402837. doi: 10.1002/cbdv.202402837. Epub ahead of print. PMID: 39587940.

  17. Orlando IF, Shine JM, Robbins TW, Rowe JB, O’Callaghan C. Noradrenergic and cholinergic systems take centre stage in neuropsychiatric diseases of ageing. Neurosci Biobehav Rev. 2023; 149:105167. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.neubiorev.2023.105167. Epub 2023 Apr 11. PMID: 37054802.

  18. Barrett MJ, Cloud LJ, Shah H, Holloway KL. Therapeutic approaches to cholinergic deficiency in Lewy body diseases. Expert Rev Neurother. 2020;20(1):41–53. https://doiorg.publicaciones.saludcastillayleon.es/10.1080/14737175.2020.1676152. Epub 2019 Oct 12. PMID: 31577469.

  19. Ramakrishna K, Karuturi P, Siakabinga Q, Krishnamurthy TAG, Singh S, Kumari S, Kumar S, Sobhia GS, Rai ME. Indole-3 carbinol and diindolylmethane mitigated β-Amyloid-Induced neurotoxicity and acetylcholinesterase enzyme activity: in Silico, in vitro, and network Pharmacology study. Diseases. 2024;12(8):184. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/diseases12080184. PMID: 39195183; PMCID: PMC11354007.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Tripathi PN, Lodhi A, Rai SN, Nandi NK, Dumoga S, Yadav P, Tiwari AK, Singh SK, El-Shorbagi AA, Chaudhary S. Review of pharmacotherapeutic targets in Alzheimer’s disease and its management using traditional medicinal plants. Degener Neurol Neuromuscul Dis. 2024;14:47–74. PMID: 38784601; PMCID: PMC11114142.

    PubMed  PubMed Central  Google Scholar 

  21. Kakarla R, Karuturi P, Siakabinga Q, Kasi Viswanath M, Dumala N, Guntupalli C, Nalluri BN, Venkateswarlu K, Prasanna VS, Gutti G, Yadagiri G, Gujjari L. Current Understanding and future directions of cruciferous vegetables and their phytochemicals to combat neurological diseases. Phytother Res. 2024;38(3):1381–99. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/ptr.8122. Epub 2024 Jan 12. PMID: 38217095.

    Article  CAS  PubMed  Google Scholar 

  22. Ramakrishnan M, Fahey JW, Zimmerman AW, Zhou X, Panjwani AA. The role of isothiocyanate-rich plants and supplements in neuropsychiatric disorders: a review and update. Front Nutr. 2024;11:1448130. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fnut.2024.1448130. PMID: 39421616; PMCID: PMC11484503.

    Article  PubMed  PubMed Central  Google Scholar 

  23. Singh AA, Yadav D, Khan F, Song M. Indole-3-Carbinol and its derivatives as neuroprotective modulators. Brain Sci. 2024;14(7):674. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/brainsci14070674. PMID: 39061415; PMCID: PMC11274471.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Oyagbemi AA, Adejumobi OA, Ajibade TO, Asenuga ER, Afolabi JM, Ogunpolu BS, Yakubu MA. Luteolin attenuates glycerol-induced acute renal failure and cardiac complications through modulation of kim-1/NF-κB/Nrf2 signaling pathways. J Diet Suppl. 2021;18(5):543–65.

    Article  CAS  PubMed  Google Scholar 

  25. Oyagbemi AA, Adebayo AK, Adebiyi OE, Adigun KO, Folarin OR, Esan OO, Oguntibeju OO. Leaf extract of Anacardium occidentale ameliorates biomarkers of neuroinflammation, memory loss, and neurobehavioral deficit in N (ω)-nitro-L-arginine Methyl ester (L-NAME) treated rats. Biomarkers. 2023;28(3):263–72.

    Article  CAS  PubMed  Google Scholar 

  26. Oyagbemi AA, Ajibade TO, Esan OO, Adetona MO, Awoyomi OV, Omobowale TO, Oguntibeju OO. 2024. Cardioprotective and renoprotective effects of melatonin and vitamin E on fluoride-induced hypertension and renal dysfunction in rats. Comp Clin Path. 2024; 33(1):33–45.

  27. Pandit N, Kulkarni S, Singhvi G. Effect of green tea on human brain health. In Nutraceutical Fruits and Foods for Neurodegenerative Disorders. Academic Press. 2024; pp 301–331.

  28. Zhang J, Cui H, Yin J, Wang Y, Zhao Y, Yu J, Engelhardt UH. Separation and antioxidant activities of new acetylated EGCG compounds. Sci Rep. 2023;13(1):20964. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41598-023-48387-9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Athirojthanakij W, Rashidinejad A. Optimizing Catechin extraction from green tea waste: comparative analysis of hot water, ultrasound-assisted, and ethanol methods for enhanced antioxidant recovery. Food Sci Nutr. 2024;12(7):5121–130.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Mi J, Liu D, Zhi S, Yan X, Qin C, Xu X, Nie G. (-)‐Epigallocatechin‐3‐O‐Gallate regulates muscle growth, antioxidant status, and nutritional composition of juvenile common carp (Cyprinus Carpio L). Aquac Nutr. 2024;1:7134404.

    Article  Google Scholar 

  31. Koo SI, Noh SK. Green tea extract (GTE) is more effective than Epigallocatechin gallate (EGCG) and epicatechin (EC) in inhibiting the lymphatic absorption of cholesterol (CH) and other lipids. J Nutr. 2008;132(6):1282–88.

    Google Scholar 

  32. Payne A, Taka E, Adinew GM, Soliman KF. Molecular mechanisms of the anti-inflammatory effects of Epigallocatechin 3-gallate (EGCG) in LPS-activated bv-2 microglia cells. Brain Sci. 2023;13(4):632.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Animal Research Act. 1985 No 123. Current version for 25 March 2024 to date (accessed 6 June 2024 at 1:12).

  34. Ajibade TO, Oyagbemi AA, Omobowale TO, Asenuga ER, Afolabi JM, Adedapo AA. Mitigation of diazinon-induced cardiovascular and renal dysfunction by Gallic acid. Interdiscip Toxicol. 2016;9(2):66–77.

    Article  CAS  PubMed  Google Scholar 

  35. Isbrucker RA, Edwards JA, Wolz E, Davidovich A, Bausch J. Safety studies on Epigallocatechin gallate (EGCG) preparations. Part 2: dermal, acute and short-term toxicity studies. Food Chem Toxicol. 2006;44(5):636–50.

    Article  CAS  PubMed  Google Scholar 

  36. Igado OO, Andrioli A, Azeez IA, Girolamo F, Errede M, Aina OO, Glaser J, Holzgrabe U, Bentivoglio M, Olopade JO. The ameliorative effects of a phenolic derivative of Moringa oleifera leave against vanadium-induced neurotoxicity in mice. IBRO Rep. 2020;9:164–82.

    Article  PubMed  PubMed Central  Google Scholar 

  37. Hall CS. Drive and emotionality: factors associated with adjustment in the rat. J Comp Psychol. 1934;17(1):89.

    Article  Google Scholar 

  38. Pellow S, File SE. Anxiolytic and anxiogenic drug effects on exploratory activity in an elevated plus-maze: a novel test of anxiety in the rat. Pharmacol Biochem Behav. 1986;24(3):525–9.

    Article  CAS  PubMed  Google Scholar 

  39. Jansone B, Dzirkale Z, Jekabsons K, Pilipenko V, Beitnere U, Māgure I, Kluša V. Spruce needle polyprenols protect against atorvastatin-induced muscle weakness and do not influence central nervous system functions in rats. Proc Latv Acad Sci B: Nat Exact Appl Sci. 2016;70(1):13–20.

    CAS  Google Scholar 

  40. Hoffman E, Winder SJ. A modified wire hanging apparatus for small animal muscle function testing. PLoS Curr. 2016;8:ecurrentsmd1e2bec4e78697b7b0ff80ea25a1d38be.

    Google Scholar 

  41. Ennaceur A, Delacour J. A new one-trial test for Neurobiological studies of memory in rats. 1: Behavioral data. Behav Brain Res. 1988;31(1):47–59.

    Article  CAS  PubMed  Google Scholar 

  42. Varshney R, Kale RK. Effects of calmodulin antagonists on radiation-induced lipid peroxidation in microsomes. Int J Radiat Biol. 1990;58(5):733–43.

    Article  CAS  PubMed  Google Scholar 

  43. Wolff SP. Ferrous ion oxidation in presence of ferric ion indicator xylenol orange for measurement of hydroperoxides. Methods in Enzymology 233. Academic Press. 1994; pp.182– 89.

  44. Jollow DJ, Mitchell JR, Zampaglione N, Gillette JR. N bromobenzene induced liver necrosis. Protective role of glutathione and evidence for 3, 4 bromobenzene oxide as the hepatotoxic metabolite. Pharmacol. 1974;11:151–69. https://doiorg.publicaciones.saludcastillayleon.es/10.1159/000136485.

    Article  CAS  Google Scholar 

  45. Beutler E, Mary KY. Erythrocyte glutathione reductase. Blood. 1963;21(5):573–85.

    Article  CAS  PubMed  Google Scholar 

  46. Misra HP, Fridovich I. Superoxide dismutase: a photochemical augmentation assay. Arch Biochem Biophys. 1977;181(1):308–12.

    Article  CAS  PubMed  Google Scholar 

  47. Oyagbemi AA, Omobowale TO, Akinrinde AS, Saba AB, Ogunpolu BS, Daramola O. Lack of reversal of oxidative damage in renal tissues of lead acetate-treated rats. Environ Toxicol. 2015;30(11):1235–43.

    Article  PubMed  Google Scholar 

  48. Habig WH, Pabst MJ, Jakoby WB. Glutathione S-transferases. The first enzymatic step in mercapturic acid formation. J Biol Chem. 1974;249(22):30–9.

    Google Scholar 

  49. Vodovotz Y. Modified microassay for serum nitrite and nitrate. Biotechniques. 2024;20(3):120–27.

    Google Scholar 

  50. Dingova D, Leroy J, Check A, Garaj V, Krejci E, Hrabovska A. 2014. Optimal detection of cholinesterase activity in biological samples: Modifications to the standard Ellman’s assay. Anal Biochem. 2014; 462:67–75.

  51. Maestri AC, Raboni SM, Cogo LL, Rossi MV, Nogueira KS. Standardisation and validation of an in-house quantitative real-time polymerase chain reaction (qPCR) assay for the diagnosis of clostridioides difficile infection. J Microbiol Methods. 2022;193:106399. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.mimet.2021.106399. Epub 2021 Dec 24. PMID: 34958834.

    Article  CAS  PubMed  Google Scholar 

  52. Tukey J. Comparing individual means in the analysis of variance. Biometrics. 1949;5(2):99–114.

    Article  CAS  PubMed  Google Scholar 

  53. Seibenhener ML, Wooten MC. Use of the open field maze to measure locomotor and anxiety-like behavior in mice. J Vis Exp. 2015;96:52434.

    Google Scholar 

  54. Chen L, Lu Y, Hua X, Zhang H, Sun S, Han C. Three methods of behavioural testing to measure anxiety– A review. Behav Process. 2024;215:104997.

  55. Ennaceur A. Tests of unconditioned anxiety- pitfalls and disappointments. Physiol Behav. 2014;135:55–71.

    Article  CAS  PubMed  Google Scholar 

  56. Costall B, Jones BJ, Kelly ME, Naylor RJ, Tomkins DM. Exploration of mice in a black and white test box: validation as a model of anxiety. Pharmacol Biochem Behav. 1989;32(3):777–85.

    Article  CAS  PubMed  Google Scholar 

  57. Tachibana T. The open-field test: an approach from multivariate analysis. Anim Learn Behav. 1980;8(3):465–67.

    Article  Google Scholar 

  58. Tachibana T. Open-field test for rats: correlational analysis. Psychol Rep. 1982;50(3):899–910.

    Article  Google Scholar 

  59. Lauretani F, Giallauria F, Testa C, Zinni C, Lorenzi B, Zucchini I.,… Maggio MG.Dopamine Pharmacodynamics: New Insights. Int J Mol Sci. 2024; 25(10):5293.

  60. Tsuboi D, Nagai T, Yoshimoto J, Kaibuchi K. Neuromodulator regulation and emotions: insights from the crosstalk of cell signaling. Front Mol Neurosci. 2024;17:1376762.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  61. Daniali M, Baeeri M, Farhadi R, Gholami M, Hassani S, Navaei-Nigjeh M, Rahimifard M, Abdollahi M. Molecular evidence on the inhibitory potential of Metformin against chlorpyrifos-induced neurotoxicity. Toxics. 2022;10(4):197.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  62. Yadav B, Kaur S, Yadav A, Verma H, Kar S, Sahu BK, Mantha AK. Implications of organophosphate pesticides on brain cells and their contribution toward progression of Alzheimer’s disease. J Biochem Mol Toxicol. 2024a;38(3):e23660.

    Article  CAS  PubMed  Google Scholar 

  63. Yadav V, Mythri C, Kumarasamy M. Natural products as potential modulators of pro-inflammatory cytokines signalling in Alzheimer’s disease. Brain Behav Immun. 2024b;5:100048.

    Google Scholar 

  64. Imam A, Sulaiman NA, Oyewole AL, Chengetanai S, Williams V, Ajibola MI, Folarin RO, Muhammad AS, Shittu ST, Ajao MS. Chlorpyrifos-and dichlorvos-induced oxidative and neurogenic damage elicits neuro-cognitive deficits and increases anxiety-like behavior in wild-type rats. Toxics. 2018;6(4):71.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  65. Banke IS, Ambali SF, Mohammed B, Suleiman MM, Onukak C, Ayo JO. Effects of melatonin on changes in cognitive performances and brain malondialdehyde concentration induced by sub-chronic coadministration of Chlorpyrifos and Cypermethrin in male Wister rats. J Trop Biomed. 2014;4(4):318–23.

    Article  CAS  Google Scholar 

  66. Nan S, Wang P, Zhang Y, Fan J. Epigallocatechin-3-Gallate provides protection against Alzheimer’s Disease-Induced learning and memory impairments in rats. Drug Des Devel Ther. 2021;15:2013–24. PMID: 34012254; PMCID: PMC8128347.

    Article  PubMed  PubMed Central  Google Scholar 

  67. D’Souza LC, Paithankar JG, Stopper H, Pandey A, Sharma A. Environmental Chemical-Induced reactive oxygen species generation and immunotoxicity: A comprehensive review. Antioxid Redox Signal. 2024;40(10–12):691–714.

    Article  PubMed  Google Scholar 

  68. Veith A, Moorthy B. Role of cytochrome P450s in the generation and metabolism of reactive oxygen species. Curr Opin Toxicol. 2018;7:44–51.

    Article  PubMed  Google Scholar 

  69. Trachootham D, Lu W, Ogasawara MA, Nilsa RD, Huang P. Redox regulation of cell survival. Antioxid Redox Signal. 2008;10:1343–74.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  70. Di Nunzio M, Valli V, Bordoni A. Pro-and anti-oxidant effects of polyunsaturated fatty acid supplementation in HepG2 cells. Prostaglandins Leukot. Essent. Fat Acids. 2011;85(3–4):121–7.

    Article  Google Scholar 

  71. Akbel E, Arslan-Acaroz D, Demirel HH, Kucukkurt I, Ince S. The subchronic exposure to malathion, an organophosphate pesticide, causes lipid peroxidation, oxidative stress, and tissue damage in rats: the protective role of Resveratrol. Toxicol Res. 2018;7(3):503–12.

    Article  CAS  Google Scholar 

  72. Gupta PS, Karmakar S, Biswas I, Ghosal J, Banerjee A, Roy S, Bhattacharjee S. Vitamin E alleviates Chlorpyrifos induced glutathione depletion, lipid peroxidation and iron accumulation to inhibit ferroptosis in hepatocytes and mitigate toxicity in zebrafish. Chemosphere. 2024;359:142252.

    Article  PubMed  Google Scholar 

  73. Yasui K, Baba A. Therapeutic potential of superoxide dismutase (SOD) for resolution of inflammation. J Inflamm Res. 2006;55:359–63.

    Article  CAS  Google Scholar 

  74. Park H, Kim HS, Abassi S, Bui QTN, Ki JS. Two novel glutathione S-transferase (GST) genes in the toxic marine dinoflagellate Alexandrium Pacificum and their transcriptional responses to environmental contaminants. Sci Total Environ. 2024;915:169983.

    Article  CAS  PubMed  Google Scholar 

  75. Okamoto OK, Colepicolo P. Response of superoxide dismutase to pollutant metal stress in the marine dinoflagellate Gonyaulax polyedra. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol. 1998;119(1):67–73.

    Article  CAS  PubMed  Google Scholar 

  76. Guo G, Yan-Sanders Y, Lyn-Cook BD, Wang T, Tamae D, Ogi J, Khaletskiy A, Li Z, Weydert C, Longmate JA, Huang TT, Spitz DR, Oberley LW, Li JJ. Manganese superoxide dismutase-mediated gene expression in radiation-induced adaptive responses. Mol Cell Biol. 2003;23(7):2362–78.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  77. Mazari AMA, Zhang L, Ye ZW, Zhang J, Tew KD, Townsend DM. The multifaceted role of glutathione S-transferases in health and disease. Biomolecules. 2023;13(4):688.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  78. Otitoju O, Onwurah IN, Otitoju GT, Ugwu CE. Oxidative stress and superoxide dismutase activity in brain of rats fed with diet containing permethrin. Biokemistri. 2008;20(2):93–8.

    Google Scholar 

  79. Nwogueze BC, Ojieh AE, Aloamaka CP, Igweh JC, Onyesom I. Levels of glutathione-related antioxidants in some tissues of stressed Wistar rats. Indian J Physiol Pharmacol. 2021;65(3):167–76.

    Article  CAS  Google Scholar 

  80. Oruç EÖ, Usta D. Evaluation of oxidative stress responses and neurotoxicity potential of Diazinon in different tissues of Cyprinus carpio. Environ Toxicol Pharmacol. Jan 2007;23(1):48–55. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.etap.2006.06.005. Epub 2006 Jun 27. PMID: 21783736.

    Article  CAS  PubMed  Google Scholar 

  81. Bellefontaine N, Hanchate NK, Parkash J, Campagne C, De Seranno S, Clasadonte J, de d’Anglemont X, Prevot V. Nitric oxide as key mediator of neuron-to-neuron and endothelia-to-glia communication involved in the neuroendocrine control of reproduction. Neuroendocrinol. 2011;93(2):74–89.

    Article  CAS  Google Scholar 

  82. Calabrese V, Mancuso C, Calvani M, Rizzarelli E, Butterfield DA, Giuffrida Stella AM. Nitric oxide in the central nervous system: neuroprotection versus neurotoxicity. Nat Rev Neurosci. 2007;8(10):766–75.

    Article  CAS  PubMed  Google Scholar 

  83. Wei T, Chen C, Hou J, Xin W, Mori A. Nitric oxide induces oxidative stress and apoptosis in neuronal cells. Biochim Biophys Acta Mol Cell Res. 2000;1498(1):72–9.

    Article  CAS  Google Scholar 

  84. Reiner E, Plestina R. Regeneration of cholinesterase activities in humans and rats after Inhibition by O,O-dimethyl-2,2-dichlorovinyl phosphate. Toxicol Appl Pharmacol. 1979;49(3):451–4.

    Article  CAS  PubMed  Google Scholar 

  85. Maiorino M, Bosello V, Ursini F, Foresta C, Garolla A, Scapin M, Sztajer H, Flohe L. Genetic variations of gpx-4 and male infertility in humans. Biol Reprod. 2003;68(4):1134–41.

    Article  CAS  PubMed  Google Scholar 

  86. Weaver K, Skouta R. The Selenoprotein glutathione peroxidase 4: from molecular mechanisms to novel therapeutic opportunities. Biomedicines. 2022;10(4):891.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  87. Rose-John S, Jenkins BJ, Garbers C, Moll JM, Scheller J. Targeting IL-6 trans-signalling: past, present and future prospects. Nat Rev Immunol. 2023;23(10):666–81.

    Article  CAS  PubMed  Google Scholar 

  88. Leone GM, Mangano K, Petralia MC, Nicoletti F, Fagone P. Past, present and (foreseeable) future of biological anti-TNF alpha therapy. J Clin Med. 2023;12(4):1630.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  89. Hu F, Shi L, Liu X, Chen Y, Zhang X, Jia Y, Liu X, Guo J, Zhu H, Liu H, Xu L, Li Y, Wang P, Fang X, Xue J, Xie Y, Wei C, Song J, Zheng X, Liu Y, Li Y, Ren L, Xu D, Lu L, Qiu X, Mu R, He J, Wang M, Zhang X, Liu W, Li Z. Proinflammatory phenotype of B10 and B10pro cells elicited by TNF-α in rheumatoid arthritis. Ann Rheum Dis. 2024;83(5):576–88.

    Article  CAS  PubMed  Google Scholar 

  90. Runwal G, Edwards RH. The membrane interactions of synuclein: physiology and pathology. Annu Rev Pathol. 2021;16(1):465–85.

    Article  CAS  PubMed  Google Scholar 

  91. Soni R, Mathur K, Shah J. An update on new-age potential biomarkers for Parkinson’s disease. Ageing Res Rev. 2024;94(1):102208.

    Article  CAS  PubMed  Google Scholar 

  92. Mazzetti S, Calogero AM, Pezzoli G, Cappelletti G. Cross-talk between α-synuclein and the microtubule cytoskeleton in neurodegeneration. Exp Neurol. 2023;359:114251.

    Article  CAS  PubMed  Google Scholar 

  93. Serratos IN, Hernández-Pérez E, Campos C, Aschner M, Santamaría A. An update on the critical role of α-synuclein in Parkinson’s disease and other synucleinopathies: from tissue to cellular and molecular levels. Mol Neurobiol. 2022;59(1):620–42. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s12035-021-02596-3. Epub 2021 Nov 8.

    Article  CAS  PubMed  Google Scholar 

  94. Peña-Bautista C, Casas-Fernández E, Vento M, Baquero M, Cháfer-Pericás C. Stress and neurodegeneration. Clin Chim Acta. 2020;503:163–68.

    Article  PubMed  Google Scholar 

  95. Searles Nielsen S, Checkoway H, Zhang J, Hofmann JN, Keifer MC, Paulsen M, Farin FM, Cook TJ, Simpson CD. Blood α-synuclein in agricultural pesticide handlers in central Washington state. Environ Res. 2015;136:75–81. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.envres.2014.10.014. Epub 2014 Nov 20. PMID: 25460623; PMCID: PMC4548290.

    Article  CAS  PubMed  Google Scholar 

  96. Kim KY, Shin KY, Chang KA. GFAP as a potential biomarker for Alzheimer’s disease: a systematic review and meta-analysis. Cells. 2023;12(9):1309.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  97. Sofroniew MV. Astrocyte cells in the brain have immune memory. Nature. 2024;627(8005):744–45.

    Article  CAS  PubMed  Google Scholar 

  98. Sánchez-Juan P, Valeriano-Lorenzo E, Ruiz-González A, Pastor AB, Rodrigo Lara H, López-González F, Rábano A. Serum GFAP levels correlate with astrocyte reactivity, post-mortem brain atrophy and neurofibrillary tangles. Brain. 2024;147(5):1667–79.

    Article  PubMed  PubMed Central  Google Scholar 

  99. Avila J, Jiménez JS, Sayas CL, Bolós M, Zabala JC, Rivas G, Hernández F. Tau structures. Front Aging Neurosci. 2016;8:262. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fnagi.2016.00262.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  100. Peng N, Nakamura F. Microtubule-associated proteins and enzymes modifying tubulin. Cytoskeleton. 2023;80(3–4):60–76.

    Article  CAS  PubMed  Google Scholar 

  101. Goedert M, Spillantini MG, Crowther RA. A brief history of Tau. Clin Chem. 2015;61(11):1417–18.

    Article  CAS  PubMed  Google Scholar 

  102. Pragati R, Sarkar S. Reinstated activity of human Tau-induced enhanced insulin signaling restricts disease pathogenesis by regulating the functioning of kinases/phosphatases and Tau hyperphosphorylation in Drosophila. Mol Neurobiol. 2024;61(2):982–1001.

    Article  CAS  PubMed  Google Scholar 

  103. Shi H, Zhao Y. Modulation of Tau pathology in Alzheimer’s disease by dietary bioactive compounds. Int J Mol Sci. 2024;25(2):831.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  104. Kwan AT, Arfaie S, Therriault J, Azizi Z, Lussier FZ, Tissot C, Rosa-Neto P. Medial Temporal Tau predicts memory decline in cognitively unimpaired elderly. Brain Commun. 2023;5(1):fcac325.

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

The authors gratefully acknowledge the technical assistance of Mr Agboola and Mrs Olawoyin, both of the Department of Veterinary Physiology and Biochemistry, University of Ibadan, Ibadan, Nigeria.

Funding

No funding was received for this study.

Author information

Authors and Affiliations

  1. Department of Veterinary Physiology and Biochemistry, Faculty of Veterinary Medicine, University of Ibadan, Ibadan, Nigeria

    Charles Etang Onukak, Temitayo Olabisi Ajibade, Adewunmi Victoria Adeogun, Ademola Adetokunbo Oyagbemi & Olufunke Eunice Ola-Davies

  2. Developmental Neurobiology and Forensic Anatomy Unit, Department of Anatomy, College of Medicine, University of Ibadan, Ibadan, Nigeria

    Omowumi Moromoke Femi-Akinlosotu

  3. Department of Biomedical Laboratory Science, College of Medicine, University of Ibadan, Ibadan, Oyo State, Nigeria

    Oluwabusayo Racheal Folarin

  4. Neuroscience Unit, Department of Veterinary Anatomy, Faculty of Veterinary Medicine, University of Ibadan, Ibadan, Nigeria

    Adedunsola Adewunmi Obasa, Olumayowa Olawumi Igado & James Olukayode Olopade

  5. Department of Veterinary Medicine, Faculty of Veterinary Medicine, University of Ibadan, Ibadan, Nigeria

    Oluwaseun Olarenwaju Esan & Temidayo Olutayo Omobowale

  6. Federal College of Animal Health and Production Technology, Ibadan, Nigeria

    Taiwo Olaide Oyagbemi

  7. Phytomedicine and Phytochemistry Group, Department of Biomedical Sciences, Faculty of Health and Wellness Sciences, Cape Peninsula University of Technology, Bellville, South Africa

    Oluwafemi Omoniyi Oguntibeju

  8. Department of Environmental & Interdisciplinary Sciences, College of Science, Engineering & Technology, Vascular Biology Unit, Center for Cardiovascular Diseases, COPHS, Texas Southern University, Houston, TX, USA

    Momoh Audu Yakubu

Authors
  1. Charles Etang Onukak
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Omowumi Moromoke Femi-Akinlosotu
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Adedunsola Adewunmi Obasa
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Oluwabusayo Racheal Folarin
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Temitayo Olabisi Ajibade
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Olumayowa Olawumi Igado
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Oluwaseun Olarenwaju Esan
    View author publications

    You can also search for this author inPubMed Google Scholar

  8. Taiwo Olaide Oyagbemi
    View author publications

    You can also search for this author inPubMed Google Scholar

  9. Adewunmi Victoria Adeogun
    View author publications

    You can also search for this author inPubMed Google Scholar

  10. Ademola Adetokunbo Oyagbemi
    View author publications

    You can also search for this author inPubMed Google Scholar

  11. Olufunke Eunice Ola-Davies
    View author publications

    You can also search for this author inPubMed Google Scholar

  12. Temidayo Olutayo Omobowale
    View author publications

    You can also search for this author inPubMed Google Scholar

  13. James Olukayode Olopade
    View author publications

    You can also search for this author inPubMed Google Scholar

  14. Oluwafemi Omoniyi Oguntibeju
    View author publications

    You can also search for this author inPubMed Google Scholar

  15. Momoh Audu Yakubu
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

Conceptualization– Ademola Oyagbemi, Omobowale, Ajibade; Animal experiments– Onukak, Obasa, Adeogun; Histological and biochemical analyses– Onukak, Igado, Obasa, Femi-Akinlosotu, Ademola Oyagbemi, Ajibade, Omobowale, Folarin, Esan, Taiwo Oyagbemi, Oguntibeju, Yusuf, Yakubu, Ola-Davies, Olopade; Data analysis and interpretation– Ademola Oyagbemi, Obasa, Igado, Femi-Akinlosotu, Omobowale; Initial manuscript draft– Onukak, Ademola Oyagbemi, Igado; manuscript editing, review and final version– Onukak, Igado, Obasa, Femi-Akinlosotu, Ademola Oyagbemi, Ajibade, Omobowale, Folarin, Esan, Taiwo Oyagbemi, Oguntibeju, Yusuf, Yakubu, Ola-Davies, Olopade; Project supervision– Omobowale, Ademola Oyagbemi, Ajibade.

Corresponding author

Correspondence to Olumayowa Olawumi Igado.

Ethics declarations

Ethical approval and consent to participate

Ethical approval for the study was obtained from the University of Ibadan, Animal Care and Use Research Committee (UI-ACUREC) with approval number UI-ACUREC/059–0324/28.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Onukak, C.E., Femi-Akinlosotu, O.M., Obasa, A.A. et al. Epigallocatechin -3- gallate mitigates diazinon neurotoxicity via suppression of pro-inflammatory genes and upregulation of antioxidant pathways. BMC Neurosci 26, 22 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12868-025-00943-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12868-025-00943-x

Keywords

BMC Neuroscience

ISSN: 1471-2202

Contact us